Partial RNA-dependent RNA Polymerase Research Articles

Detection of vesivirus in minks (Neovison vison), Italy 2021.

Vesiviruses are important animal pathogens with a broad host range, and they have also been involved in accidental contamination of cells used for the production of drugs for rare and life-threatening human diseases. A vesivirus (family Caliciviridae) was detected in minks (Neovison vison) with respiratory and neurological signs, during syndromic surveillance for SARS-CoV-2 conducted in Italy. The complete genome (8,397 nucleotides in length) of the vesivirus strain ITA/2021/mink/TE (OR130287) was obtained by combining NGS approach with 5' and 3' RACE protocols. The virus was seemingly more related (95.9-97.2% nt identity in the partial RNA-dependent RNA polymerase) to American vesivirus isolates 9/1980/US, 12/1980/US, and 20/1980/US dating back to the early 1980s than to recent mink strains. These results highlight the importance of gathering information on the virome of animals.

Genotypic diversity and recombination of norovirus GI.6[P11] associated acute gastroenteritis outbreaks in Beijing, China, from 2016 to 2019.

Norovirus (NoV) is the leading pathogen responsible for global acute gastroenteritis (AGE) outbreaks and sporadic cases. NoV evolves through gene mutation and recombination, leading to the emergence of new strains capable of causing global epidemics. This study aimed to learn the epidemiological characteristics of 39 GI.6[P11] NoV outbreaks in Beijing, China, from 2016 to 2019 and to analyze the genetic diversity and phylogenetic process of GI.6[P11] strains. The Bayesian phylogenetic analysis of partial VP1 and RNA-dependent RNA polymerase (RdRp) genes showed that GI.6[P11] strains were clustered into four subclades. Eleven whole genome sequences were obtained through the amplicon sequencing with 16 pairs of newly designed primers. The phylogenetic trees based on the whole genome and ORF1, 2, and 3 showed that the clustering of the 11 strains was consistent with that of partial VP1 and RdRp genes. The Bayesian inference revealed that the most recent ancestor (TMRCA) for the four subclades of the phylogenetic tree based on the whole genome sequences was 2012.42, 2014.81, 2011.74, and 2015.53, respectively. The recombination sites of GI.6[P11] strains in Beijing were located near the ORF1/2 junction. The histo-blood group antigens (HBGA) binding sites of GI.6[P11] strains in Beijing were conserved and there were some unique amino acid mutations in non-structural proteins in the ORF1 region.

Detection of Alpha- and Betacoronaviruses in Small Mammals in Western Yunnan Province, China.

The genetic diversity of coronaviruses (CoVs) is high, and their infection in animals has not yet been fully revealed. By RT-PCR detection of the partial RNA-dependent RNA polymerase (RdRp) gene of CoVs, we screened a total of 502 small mammals in the Dali and Nujiang prefectures of Western Yunnan Province, China. The number of overall CoV positives was 20, including β-CoV (n = 13) and α-CoV (n = 7), with a 3.98% prevalence in rectal tissue samples. The identity of the partial RdRp genes obtained for 13 strains of β-CoV was 83.42-99.23% at the nucleotide level, and it is worth noting that the two strains from Kachin red-backed voles showed high identity to BOV-36/IND/2015 from Indian bovines and DcCoV-HKU23 from dromedary camels (Camelus dromedarius) in Morocco; the nucleotide identity was between 97.86 and 98.33%. Similarly, the identity of the seven strains of α-CoV among the partial RdRp sequences was 94.00-99.18% at nucleotide levels. The viral load in different tissues was measured by quantitative RT-PCR (qRT-PCR). The average CoV viral load in small mammalian rectal tissue was 1.35 × 106 copies/g; differently, the mean CoV viral load in liver, heart, lung, spleen, and kidney tissue was from 0.97 × 103 to 3.95 × 103 copies/g, which revealed that CoV has extensive tropism in rectal tissue in small mammals (p < 0.0001). These results revealed the genetic diversity, epidemiology, and infective tropism of α-CoV and β-CoV in small mammals from Dali and Nujiang, which deepens the comprehension of the retention and infection of coronavirus in natural hosts.

Discovery and identification of a novel canine coronavirus causing a diarrhea outbreak in Vulpes

Cross-species transmission of viruses from wildlife animal reservoirs, such as bats, poses a threat to human and domestic animal health. Previous studies have shown that domestic animals have important roles as intermediate hosts, enabling the transmission of genetically diverse coronaviruses from natural hosts to humans. Here, we report the identification and characterization of a novel canine coronavirus (VuCCoV), which caused an epidemic of acute diarrhea in Vulpes (foxes) in Shenyang, China. The epidemic started on November 8, 2019, and caused more than 39,600 deaths by January 1, 2022. Full-length viral genomic sequences were obtained from 15 foxes with diarrhea at the early stage of this outbreak. The VuCCoV genome shared more than 90% nucleotide identity with canine coronavirus (CCoV) for three of the four structural genes, with the S gene showing a larger amount of divergence. In addition, 67% (10/15) of the VuCCoV genomes contained an open reading frame (ORF3) gene, which was previously only detected in CCoV-I genomes. Notably, VuCCoV had only two to three amino acid differences at the partial RNA-dependent RNA polymerase (RdRp) level to bat CoV, suggesting a close genetic relationship. Therefore, these novel VuCCoV genomes represent a previously unsampled lineage of CCoVs. We also show that the VuCCoV spike protein binds to canine and fox aminopeptidase N (APN), which may allow this protein to serve as an entry receptor. In addition, cell lines were identified that are sensitive to VuCCoV using a pseudovirus system. These data highlight the importance of identifying the diversity and distribution of coronaviruses in domestic animals, which could mitigate future outbreaks that could threaten livestock, public health, and economic growth.

First report of Watermelon Crinkle Leaf-Associated Virus (WCLaV) -1 and WCLaV-2 infecting straightneck squash in the United States.

Straightneck squash (Cucurbita pepo var. recticollis) is an important cucurbit crop in Florida. In early fall 2022, straightneck squash showing severe virus-like symptoms of yellowing, mild leaf crinkling (Supplementary Figure 1), unusual mosaic patterns and deformation on the surface of the fruit (Supplementary Figure 2), were observed in a ~15-ha straightneck squash field in Northwest FL with a disease incidence of ~ 30%. Based on the distinct symptoms and severity observed, multi-virus infection was hypothesized. Seventeen plants were sampled randomly for testing. Plants tested negative for zucchini yellow mosaic virus, cucumber mosaic virus, and squash mosaic virus, using ImmunoStrips® (Agdia, USA). Total RNA was extracted from 17 squash plants using Quick-RNA Mini Prep (Cat No.11-327, Zymo, USA). A conventional OneTaq® RT-PCR Kit (Cat No. E5310S, NEB, USA) was used to test plants for cucurbit chlorotic yellows virus (CCYV) (Jailani et al., 2021a) and watermelon crinkle leaf-associated virus (WCLaV-1) and WCLaV-2 (Hernandez et al., 2021). Plants were negative for CCYV and 12 out 17 plants were positive for WCLaV-1 and WCLaV-2 (genus Coguvirus, family Phenuiviridae) using specific primers targeting both RNA-dependent RNA polymerase (RdRP) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). In addition, these 12 straightneck squash plants were also positive for watermelon mosaic potyvirus (WMV) based on RT-PCR and sequencing (Jailani et al., 2021b). The partial RdRP sequences for WCLaV-1 (OP389252) and WCLaV-2 (OP389254) shared 99% and 97.6% nt identity with isolates KY781184 and KY781187, respectively from China; the partial MP sequences for WCLaV-1 (OP389253) and WCLaV-2 (OP389255) shared 98.3% and 95.6% nt identity with isolate from Brazil (LC636069) and from China (MW751425), respectively. Additionally, the presence or absence of WCLaV-1 and WCLaV-2 were further confirmed using SYBR® Green-based real-time RT-PCR assay using different specific MP primers for WCLaV-1 (Adeleke et al., 2022), and newly designed specific MP primers for WCLaV-2 (WCLaV-2FP TTTGAACCAACTAAGGCAACATA/WCLaV-2RP-CCAACATCAGACCAGGGATTTA). Both viruses were detected in 12 out of 17 straightneck squash plants validating the conventional RT-PCR results. Co-infection of WCLaV-1 and WCLaV-2 with WMV resulted in more severe symptoms on leaves and fruits. Previously, both viruses were first reported in the USA on watermelon in Texas, (Hernandez et al., 2021), Florida (Hendricks et al., 2021), OK (Gilford and Ali., 2022), GA (Adeleke et al., 2022) and Zucchini in Florida (Iriarte et al., 2023). This is the first report of WCLaV-1 and WCLaV-2 on straightneck squash in the United States. These results indicate that WCLaV-1 and WCLaV-2 either in single or mixed infections are effectively spreading to other cucurbits beyond watermelon in FL. The need to assess mode(s) of transmission of these viruses is becoming more critical to develop best management practices.

Porcine Sapovirus in Northern Vietnam: Genetic Detection and Characterization Reveals Co-Circulation of Multiple Genotypes.

Porcine sapovirus (PoSaV) has been reported in many countries over the world, which may cause gastroenteritis symptoms in pigs with all ages. There has been no report on PoSaV infection in Vietnam up to now. In this study, a total of 102 samples were collected from piglets, fattening pigs, and sows with diarrhea in several cities and provinces in northern Vietnam. The PoSaV genome was examined using polymerase chain reaction (PCR). Sequencing of the partial RNA-dependent RNA polymerase (RdRp) gene sequences (324 bp) was performed. Of the 102 tested samples, 10 (9.8%) and 7/20 (35%) were detected as positive for the PoSaV RdRp gene using the PCR method at the individual and farm levels, respectively. Genetic analysis of the partial RdRp gene region of about 324 bp indicated that the nucleotide identity of the current 10 Vietnamese viral strains ranged from 61.39% to 100%. Among the 10 strains obtained, 8 belonged to genotype III and the remaining 2 strains were clustered in genotype VIII. The Vietnamese genotype III viruses formed two sub-clusters. The Vietnamese PoSaV strains were closely related to PoSaVs reported in South Korea, Venezuela, and the Netherlands. This research was the first to describe PoSaV infection in northern Vietnam during 2022-2023.

The emergence of recombinant norovirus GII.12[P16] and predominance of GII.3[P12] strains in pediatric patients with acute gastroenteritis in Thailand, 2019-2020.

Norovirus (NoV) and sapovirus (SaV) are important pathogens that cause acute gastroenteritis (AGE) in all age groups, commonly in children worldwide. Recently, a number of studies have reported a wide variety of NoV recombinant strains. This study aimed to investigate the distribution of NoV and SaV recombinant strains circulating in Chiang Mai, Thailand, during 2019-2020. One hundred and twenty-four NoV and seven SaV strains detected in children admitted to the hospital with AGE were included in this study. The partialRNA-dependent RNA-polymerase(RdRp)/VP1 regions of these NoV and SaV strains were analyzed by phylogenetic analysis, Simplot, and RDP software. Overall, eight recombination patterns of NoV were detected. NoV GII.4[P16] was the most common strain detected (39.1%), followed by GII.3[P12] (25.0%), GII.4[P31] (17.2%), and other recombinant strains were detected at a lower rate. NoV GII.12[P16] strains were detected for the first time in Thailand. For SaV, none of the recombinant strains was detected. All SaV strains, GI.1/GI.1, GI.2/GI.2, and GII.5/GII.5, exhibited VP1 genotype corresponded to RdRp genotype. In conclusion, this study demonstrates the distribution and diversity of NoV and SaV recombinant strains circulating in pediatric patients with AGE in Chiang Mai, during 2019-2020 with the emergence of NoV GII.3[P12] and GII.12[P16].

Co-circulation of coronavirus and avian influenza virus in wild birds in Shanghai (2020-2021).

Co‐infection of SARS‐CoV‐2 and influenza viruses has been reported worldwide in humans. Wild birds are natural reservoir hosts for coronaviruses (CoVs) and avian influenza viruses (AIVs). It is unknown whether co‐infection with these two types of viruses occurs in wild birds. In this study, the prevalence of co‐infection with CoV and AIV in wild birds in Shanghai, China during 2020–2021 was investigated by detecting these viruses in cloacal, tracheal, and faecal samples. Results showed that the overall rate of samples positive for both CoV and AIV was 3.3% (82/2510; 95% confidence interval [CI]: 2.6%–4.0%), and that was mainly from Anseriformes. In CoV‐positive samples, 38.9% (82/211; 95% CI: 32.5%–45.6%) of them had both CoVs and AIVs, whereas only 26.9% (82/305; 95% CI: 22.2%–32.1%) of AIV‐positive samples had both CoVs and AIVs. These results suggest that CoV infection in wild birds renders them more susceptible to AIV infection. Phylogenetic analysis based on partial RNA‐dependent RNA polymerase (RdRp) gene sequences of CoVs revealed that gamma‐CoVs mainly cluster with duck CoVs and that delta‐CoVs are more diversified and cluster with those of various wild birds. Continual surveillance is necessity to monitor the transmission and evolution of co‐infection of these two types of viruses in their natural hosts.

Norovirus Genetic Diversity in Children under Five Years Old with Acute Diarrhea in Mozambique (2014-2015).

Norovirus (NoV) is the second most important cause of viral diarrheal disease in children worldwide after rotavirus and is estimated to be responsible for 17% of acute diarrhea in low-income countries. This study aimed to identify and report NoV genotypes in Mozambican children under the age of five years with acute diarrhea. Between May 2014 and December 2015, stool specimens were collected within the Mozambique Diarrhea National Surveillance (ViNaDia) and tested for NoV genogroups I (GI) and II (GII) using conventional reverse transcriptase-polymerase chain reaction (RT-PCR). Partial capsid and RNA-dependent RNA polymerase (RdRp) nucleotide sequences were aligned using the Muscle tool, and phylogenetic analyses were performed using MEGA X. A total of 204 stool specimens were tested for NoV. The detection rate of NoV was 14.2% (29/204). The presence of NoV was confirmed, by real-time RT-PCR (RT-qPCR), in 24/29 (82.8%) specimens, and NoV GII predominated (70.8%; 17/24). NoV GII.4 Sydney 2012[P31] was the predominant genotype/P-type combination detected (30.4%; 7/23). This is the first study which highlights the high genetic diversity of NoV in Mozambican children and the need to establish a continuous NoV surveillance system.

Incidence and genetic diversity of grapevine leafroll-associated virus 3 (GLRaV-3) isolates in Turkey

Grapevine leafroll-associated virus 3 (GLRaV-3) is the most important virus species within the grapevine leafroll complex. It causes significant losses to growers and vineries because of its effect on grape and wine quality. A survey was conducted in the major grape-growing provinces of Turkey in 2018 to investigate distribution and the genetic diversity of GLRaV-3 in local and foreign grapevine cultivars. The genetic diversity of GLRaV-3 isolates based on partial heat-shock protein 70 homologue (Hsp70 h), partial coat protein (CP) and partial RNA-dependent RNA polymerase (RdRp) genes were determined by RT-PCR and sequencing. The infection rate of GLRaV-3 in 141 tested grapevine samples was 13.47% by DAS-ELISA and 28.36% by RT-PCR analysis. Totally, 17 amplicons from Hsp70 h, 22 isolates from RdRp and 16 isolates from CP genes were sequenced in both directions. The sequence analysis of three genes revealed that the Turkish GLRaV-3 isolates shared 91–100% nucleotide identities with the sequences of GLRaV-3 isolated deposited in the GenBank from other parts of the world without any correlation between the distribution and geographical origin.

First Report of Cucurbit Chlorotic Yellows Virus Infecting Pumpkin in India.

Pumpkin (Cucurbita moschata), a member of the family Cucurbitaceae, is widely cultivated throughout the world including India. During August 2020 to January 2021, stunted pumpkin plants (cv. Pusa Vishwas), showing chlorotic patches, mosaic, and vein banding on leaves (e-Xtra Fig.1), were observed in the experimental fields of the Indian Agricultural Research Institute (IARI), New Delhi, India. Leaf-dip electron microscopy (EM) of the symptomatic plants (12 out of 37 samples) revealed the association of long flexuous virus particles measuring 650-950nm×10-12nm, suggestive of the presence of either crinivirus or potyvirus or both. Subsequently, a reverse transcription-polymerase chain reaction (RT-PCR) was performed on RNA extracted from the samples that had long flexuous virus particles using generic primers for criniviruses i.e. CriniPol-F: GCY CCS AGR GTK AAT GA and CriniPol-R: ACC TTG RGA YTT RTC AAA targeting partial RNA-dependent RNA polymerase coding region (Martin et al. 2003) and specific primers for papaya ringspot virus (PRSV) targeting a part of 3' NIb and full coat protein (CP) gene (Basavaraj et al., 2019) separately. All tested samples were positive for both crinivirus and PRSV as expected size amplicons were obtained, accounting for about 32% prevalence. As PRSV is a well-studied virus infecting cucurbits, further work was not carried on this virus and only the RT-PCR amplicon indicative of crinivirus (~515 bp) was cloned into the pGEM-T easy cloning vector (Promega, Madison, WI) and sequenced for further confirmation of the virus presence. The obtained sequence (GenBank accession No MZ318672) shared up to 90% nucleotide and 100% amino acid sequence identity with the corresponding genomic region of a cucurbit chlorotic yellows virus (CCYV) isolate from Greece (LT841297). To confirm the identity of the crinivirus species present in the same pumpkin sample, the CP gene (753bp) was amplified and sequenced using CCYV CP gene-specific primers CP-F (5'-ATG GAG AAG ACY GAC AAT AAA CAA AAT GAT GA-3') and CP-R (5'-TTA TTT ACT ACA ACC TCC CGG TGC CAA C-3') (modified from Kheireddine et al. 2020). Sequence analysis using the BioEdit tool (version 2.0) revealed that the crinivirus present in pumpkin (KC577202) shared 95 to 100% nucleotide (and 98 to 100% amino acid) sequence identity with the corresponding gene sequences of CCYV isolates originating from cucurbitaceous hosts from diverse locations. The presence of CCYV was further validated by a whitefly transmission-based bioassay followed by RT-PCR confirmation. The bioassay was performed by the whitefly species Bemisia tabaci (biotype Asia II7) using the acquisition access period and inoculation access period of 24 hours each. Six whitefly individuals per plant were used for inoculating ten pumpkin plants (cv. Pusa Vishwas) at the first true leaf stage grown in pots containing soilrite as the medium in insect-proof cages. All ten plants inoculated using whiteflies exhibited chlorosis and stunting symptoms 12-15 days post-inoculation (e-Xtra Fig.2) and were found positive for CCYV in RT-PCR assay performed using CCYV CP gene-specific primers. Though CCYV had been reported worldwide (Tzanetakis et al. 2013), its occurrence had not been reported from India. Results of the present study confirm the infection of pumpkin plants by CCYV and constitute the first report of its presence in India. Further, there is a need to investigate the extent of its spread and impact of this virus on the production of cucurbitaceous crops in the country.

First Report of Capsicum chlorosis virus Infecting Chromolaena odorata in Yunnan, China.

Capsicum chlorosis virus (CaCV) is a negative sense ssRNA virus belonging to the genus Orthotospovirus in the family Tospoviridae. It was first discovered in Australia, and then reported in other places including Thailand, China, India, Greece, and United States (Zheng et al.2011; Melzer et al.2014; Chrysoula et al. 2018; Abudurexiti et al. 2019). CaCV infects plants of the families Amaranthaceae, Apocynaceae, Chenopodiaceae, Cucurbitaceae, Amaryllidaceae, Fabaceae and Solanaceae (Basavaraj et al. 2017; Basavaraj et al. 2020). Chromolaena odorata L. (commonly known as Feiji cao in China) is an invasive weedy herb that belongs to the genus Eupatorium (family Asteraceae), and is native to Central America. In May 2020, serrated chlorotic ring and chlorotic ringspots resembling symptoms of orthotospovirus infection (Supplementary Figure 1) was observed on the leaves of C. odorata plants in Honghe County, Yunnan. Three symptomatic leaf samples were collected and double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) was performed using antisera targeting Tomato spotted wilt virus (TSWV), Calla lily chlorotic spot virus (CCSV), Capsicum chlorosis virus (CaCV), and Tomato zonate spot virus (TZSV) (Proteintech Group, Inc., China). Buffer solution and healthy leaves were used as a blank and negative controls, respectively. All three symptomatic samples showed positive reactions with only CaCV antiserum (OD450 of 0.315-0.345 relative to 0.078 and 0.076 for healthy plants and the blank control, respectively. The total RNA extracted from the positive samples were further analyzed by reverse transcription-polymerase chain reaction (RT-PCR) using generic primers gL3637 (CCTTTAACAGTDGAAACAT) and gL4435c (CATDGCRCAAGARTGRTARACAGA) which were designed to amplify partial L segment encoding the RNA-dependent RNA polymerase (RdRP) of orthotospoviruses (Chu, et al. 2001). The expected ~800 bp DNA fragment was amplified from all three positive samples by RT-PCR. The amplified DNA was cloned and sequenced. BLAST search of the partial L RNA sequence (GenBank acc. nos. MW964378 to MW964380) revealed that they shared 86.2-97.4% nucleotide (nt) and 97.2-100% amino acid (aa) sequence identities with different isolates of CaCV available in GenBank with CaCV chili isolates (KU941834 to KU941836) from India sharing the highest aa identity of 100%. This confirmed the presence of CaCV in the symptomatic C. odorata plants. The 825 bp complete nucleocapsid protein (NP) of CaCV was also amplified from the samples using primers CaCV-F: ATGTCTAMCGTYAGGCAAC and CaCV-R: TYACACYTCWATAGAWGTACTAG) (Basavaraj et al. 2020), cloned, and sequenced to obtain complete S fragment-nucleocapsid protein (NP) with a size of 825 bp (MW964381 to MW964383). The pairwise comparisons of three fragments showed 85.1-98.3% nt and 87.6-99.6% aa sequence identities with different isolates of CaCV. Maximum-Likelihood phylogenetic trees inferred from the partial RdRP and complete NP aa sequences showed that the C. odorata isolates (CaCV-YN) clustered closely with CaCV tomato isolate from Taiwan and tomato (Yuxi-2013) isolate from China, respectively (Supplementary Figure 1). To our knowledge, this is the first time CaCV has been detected in C. odorata. This study will serve as an important reference for the study of host range of CaCV. Further studies will be required to determine whether thrips could transmit CaCV between C. odorata and other hosts of the virus.

Molecular Epidemiology and Characterization of Picobirnavirus in Wild Deer and Cattle from Australia: Evidence of Genogroup I and II in the Upper Respiratory Tract.

Picobirnaviruses (PBVs) have been detected in several species of animals worldwide; however, data pertaining to their presence in Australian wild and domestic animals are limited. Although PBVs are mostly found in faecal samples, their detection in blood and respiratory tract samples raises questions concerning their tropism and pathogenicity. We report here PBV detection in wild deer and cattle from southeastern Australia. Through metagenomics, the presence of PBV genogroups I (GI) and II (GII) were detected in deer serum and plasma. Molecular epidemiology studies targeting the partial RNA-dependent RNA polymerase gene were performed in a wide range of specimens (serum, faeces, spleen, lung, nasal swabs, and trachea) collected from wild deer and cattle, with PCR amplification obtained in all specimen types except lung and spleen. Our results reveal the predominance of GI and concomitant detection of both genogroups in wild deer and cattle. In concordance with other studies, the detected GI sequences displayed high genetic diversity, however in contrast, GII sequences clustered into three distinct clades. Detection of both genogroups in the upper respiratory tract (trachea and nasal swab) of deer in the present study gives more evidence about the respiratory tract tropism of PBV. Although much remains unknown about the epidemiology and tropism of PBVs, our study suggests a wide distribution of these viruses in southeastern Australia.

Detection and Molecular Characterization of Two Potyvirus Species on Cucurbits from Northwestern of Iran

Cucurbit crops belonging to the family Cucurbitaceae are one the most important horticultural crops worldwide and cultivated widely in Iran. To aim detection and phylogenetic analysis of potyvirus members, during 2015-2016, 215 leaf samples from cucumber, melon, watermelon, and squash symptomatic with deforming and reduction in leaf size, blistering, mild and severe mosaic, fruit deformation, and stunting were collected from 10 major cucurbits-growing locations in West Azerbaijan province. Following mechanical inoculation of Cucurbita pepo as an indicator plant with symptomatic cucurbit crop extracts, a variety of symptoms developed on the plants. Then, total RNA extracted from 70 symptomatic leaf samples, and partial RNA-dependent RNA polymerase (NIb) (350 bp) was amplified using universal primer pairs (NIb2F/NIb3R) by reverse transcription-polymerase chain reaction (RT-PCR). The infection by potyviruses in 38.75% of the samples was confirmed based on the result. The five PCR products belonging to different hosts at the expected size (350bp) were sequenced. One sample (Ir-Na: MH491979) was determined to be infected by the Watermelon mosaic virus (WMV) whereas four samples (Ir-Ma:MH491979, Ir-Ng:MH491980, Ir-Pi:MH491981, and Ir-Ur:MH491982) infected by Zucchini yellow mosaic virus (ZYMV). In the phylogenetic analysis based on Maximum-likelihood, three ZYMV isolates (Ir-Ng, Ir-Pi, and Ir-Ur) were placed in subgroup I whereas one isolate (Ir-Ma) was placed in subgroup II belonging to group A. Also, WMV isolate (Ir- Na) was placed in CL phylogroup.

Molecular-based cross-species evaluation of bovine coronavirus infection in cattle, sheep and goats in Ghana

BackgroundApart from the huge worldwide economic losses often occasioned by bovine coronavirus (BCoV) to the livestock industry, particularly with respect to cattle rearing, continuous surveillance of the virus in cattle and small ruminants is essential in monitoring variations in the virus that could enhance host switching. In this study, we collected rectal swabs from a total of 1,498 cattle, sheep and goats. BCoV detection was based on reverse transcriptase polymerase chain reaction. Sanger sequencing of the partial RNA-dependent RNA polymerase (RdRp) region for postive samples were done and nucleotide sequences were compared with homologous sequences from the GenBank.ResultsThe study reports a BCoV prevalence of 0.3%, consisting of 4 positive cases; 3 goats and 1 cattle. Less than 10% of all the animals sampled showed clinical signs such as diarrhea and respiratory distress except for high temperature which occurred in > 1000 of the animals. However, none of the 4 BCoV positive animals manifested any clinical signs of the infection at the time of sample collection. Bayesian majority-rule cladogram comparing partial and full length BCoV RdRp genes obtained in the study to data from the GenBank revealed that the sequences obtained from this study formed one large monophyletic group with those from different species and countries. The goat sequences were similar to each other and clustered within the same clade. No major variations were thus observed between our isolates and those from elsewhere.ConclusionsGiven that Ghana predominantly practices the extensive and semi-intensive systems of animal rearing, our study highlights the potential for spillover of BCoV to small ruminants in settings with mixed husbandry and limited separation between species.

Detection and molecular epidemiology of ferlaviruses in farmed snakes with respiratory disease in Guangxi Province, China.

We screened 104 snakes with respiratory disease, collected from 52 snake farms in Guangxi Province, China, for pathogens. Ferlaviruses were detected in 70 of 104 lung samples by reverse-transcription PCR; 34 of 52 of the snake farms were positive for ferlaviruses. No reovirus, adenovirus, sunshine virus, or nidovirus was detected in any of the snakes. We obtained 96 bacterial isolates from snake organs, of which the most commonly isolated species were Salmonella (18) and Proteus (16). Sequence analysis, based on 27 partial RNA-dependent RNA polymerase gene (L) sequences, revealed that ferlaviruses from Guangxi and the known GenBank strains clustered together and formed 3 genogroups. The nucleotide and deduced amino acid homologies of ferlaviruses were 84.3-100% and 95.0-100% within groups, respectively, and 77.0-81.6% and 90.4-95.2% between groups, respectively. Ferlaviruses from Guangxi had close genetic relationships with the known GenBank strains. Our results indicate that ferlaviruses are common in snakes with respiratory disease on the farms of Guangxi that we sampled, and that ferlavirus molecular epidemiology is both diverse and complex.

First Report of Lagenaria mild mosaic virus Infecting Bottle Gourd in India

Bottle gourd or Lagenaria siceraria (Molina) Standl. (family: Cucurbitaceae) is an annual herbaceous crop grown worldwide. It is well-known for its use in Indian ayurvedic medicine. In India, during 2016 to 2017, total annual production of bottle gourd was 2,572,000 metric tons harvested from 157,000 ha (Government of India 2017). During December 2016 and February 2017, disease symptoms such as leaf mosaic and leaf curling were observed in the bottle gourd growing fields of sub-Himalayan West Bengal, India. In severe cases, blistering and deformation of leaf lamina were also observed. Twenty such symptomatic and three healthy-looking leaf samples were collected and analyzed using transmission electron microscopy. All symptomatic samples showed the presence of 500- to 700-nm-long filamentous rod-shaped particles resembling potexviruses (Kim et al. 2010). Total RNA was isolated from all the samples (Ghawana et al. 2011) and tested through reverse transcription polymerase chain reaction (RT-PCR) with Potex5 (5′-CAYCARCARGCMAARGAYGA-3′) and Potex2RC (5′-AGCATRGCNSCRTCYTG-3′) primers that specifically amplify the partial RNA-dependent RNA polymerase (RdRp) gene of the potexviruses (van der Vlugt and Berendsen 2002). RT-PCR conditions were set up as follows: initial incubation for 30 min at 50°C and initial denaturation for 5 min at 95°C; 35 cycles of denaturation at 95°C for 1 min, annealing at 51.5°C for 1 min, product extension at 72°C for 1 min; and final extension at 72°C for 10 min. The products were visualized under ultraviolet transilluminator after running on 1% agarose gel, and amplicon size was determined. All 20 infected samples produced an amplicon of ∼530 bp, whereas the three healthy-looking samples did not produce expected amplicons. All amplicons were cloned into pGEM-T vector (Promega, Madison, WI) and were sequenced. One such sequence of sample NE-02 was submitted to GenBank as Lagenaria mild mosaic virus (LaMMoV, accession no. MG752888) and showed 78% nucleotide (nt) identity and 91% amino acid (aa) identity with LaMMoV infecting bottle gourd in Myanmar (accession no. AB546335), as determined in a BLASTn analysis. To confirm the identity of the pathogen, another primer pair, RdRP1f (5′-CACCGGTGACTCAAAGCAAA-3′) and RdRP1r (5′-CCAATRGGCCTCTTTTCMAG-3′), was designed based on the genome of LaMMoV, papaya mosaic virus, and Alternanthera mosaic virus to amplify the RdRp gene of all the three potexviruses mentioned. For the primer set RdRP1f/RdRP1r, RT-PCR conditions were similar to those described above, except for the annealing step at 57°C for 1 min. RT-PCR conducted on all 20 symptomatic samples produced an amplicon of ∼810 bp, whereas none of the healthy-looking samples tested positive with the same primer pair. This new RT-PCR fragment of the sample NE-02 was also submitted to GenBank as LaMMoV (accession no. MH998222), because it showed 82% nt identity and 99% aa identity with LaMMoV (accession no. AB546335) following BLASTn analysis. The species demarcation criteria for the genus Potexvirus is less than 72% nt (or 80% aa) identity between their coat protein or RdRp genes (Adams et al. 2004). To the best of our knowledge, this is the first report of LaMMoV infecting bottle gourd in India. The finding of this study shall aid in developing effective management strategies.

First Report of Barley Yellow Dwarf Virus-PAV Infecting Oats (Avena sativa) in Taiwan

Barley yellow dwarf virus is a group of positive-sense single stranded RNA viruses with many species belonging to the family Luteoviridae and known to cause significant yield losses of cereal crops worldwide (Irwin and Thresh 1990). Oat (Avena sativa L.), a temperate cereal crop usually grown as forage in subtropical regions, has been recently reintroduced into Taiwan as a local winter forage source. In April 2017, yellowing, V-shape reddening, and purple symptoms were observed on 7.9% of the mature leaves of the oat plants grown in the experimental field of National Taiwan University (NTU) in Taipei city, Taiwan. We collected 37 leaf samples with suspected virus-infection symptoms in the experimental field for virus screening. The samples were expressing varying degrees of yellowing, browning, or typical barley yellow dwarf virus (BYDV)-associated V-shape reddening and purple symptoms. An additional five samples with no symptoms were also collected. These 37 samples belong to 22 oat lines, including two registered cultivars and 20 unreleased breeding lines. Some lines were replicated in the field and therefore were sampled more than once. A specific reverse transcription polymerase chain reaction assay (RT-PCR) for BYDV, covering the coat protein (CP) gene and partial RNA-dependent RNA polymerase regions, was performed with the primers Shu-F (5′-TACGGTAAGTGCCCAACTCC-3′) and Yan-R (5′-TGTTGAGGAGTCTACCTATTTG-3′) on the extracted total RNA of the samples (Malmstrom and Shu 2004). Among the examined samples, only the three expressing typical BYDV symptoms tested positive, whereas the other 34 samples with solely yellowing or browning symptoms and the five symptomless samples tested negative. The samples belonged to the cultivar Swan and two breeding lines, 15-39 and 16-47; the seeds of the three symptomatic oats were all imported from the United States. We further cross-examined the three positive samples with another RT-PCR assay, using specific primer pairs targeting the BYDV CP gene (for strains PAV, MAV, and GAV): Luteo1F (5′-TTCGGMSARTGGTTGTGGTCCA-3′) and YanR-new (5′-TGTTGAGGAGTCTACCTATTTNG-3′) (Mustafayev et al. 2013; Svanella-Dumas et al. 2013). The electrophoresis analysis of the RT-PCR amplicons revealed the expected 545-bp fragment from all. The amplicons were later cloned into pCR2.1-TOPO (Invitrogen, Carlsbad, CA) for sequencing analysis. All of the sequences obtained were identical (GenBank accession nos. MF618251, MK361042, and MK361043) and showed 99% similarity to the BYDV-PAV isolates from the United States (accession nos. EF521840 and DQ115532) in GenBank. Based on the phylogenetic analysis of CP gene sequences, the BYDV-PAV Taiwan isolates and these two U.S. isolates were in the same cluster. To further confirm the results, the BYDV-PAV specific enzyme-linked immunosorbent assay on the three symptomatic samples, using the commercialized kit (Agdia, Elkhart, IN), also aligned with the prior assay and showed positive reaction results. To our knowledge, this is the first report of BYDV-PAV in Taiwan. The phylogeny analysis of the virus suggests the BYDV-PAV might have been introduced through the seeds, which had gone through one cycle of multiplication at the border between Idaho and Oregon states prior to growing in Taiwan. Because the BYDV infection on oat presented a threat to cereal crop production in Taiwan, all oat plants in the NTU experimental field were eliminated immediately to prevent the spread of the disease. Agricultural agencies were informed of the incidence, and oat growers were educated to identify the BYDV symptoms on oat. Further field surveys of BYDV on the alleged vector insects will be carried to better understand the disease biology in Taiwan and to provide information on the disease system in the Southeast Asia region.

Distribution of norovirus and sapovirus genotypes with emergence of NoV GII.P16/GII.2 recombinant strains in Chiang Mai, Thailand.

Norovirus (NoV) and sapovirus (SaV) are recognized as the causative agents of acute gastroenteritis, and NoV is one of the leading pathogens reported worldwide. This study reports on the distribution of NoV and SaV genotypes in children hospitalized with acute gastroenteritis in Chiang Mai, Thailand, from January 2015 to February 2017. From a total of 843 stool samples, 170 (20.2%) and 16 (1.9%) were identified as having NoV and SaV infections, respectively. Two samples (0.2%) were positive for both NoV and SaV. Of these, NoV GII.4 (57.2%) was the dominant genotype, followed by GII.2, GII.3, GII.17, GII.6, GII.7, GII.13, GII.14, GII.15, GII.21, GI.6, and GI.5. Among the NoV GII.4 variants, Sydney 2012 was the dominant variant during the period 2015-2016, while the other variants detected in this study were Asia 2003 and New Orleans 2009. Interestingly, an increase of NoV GII.2 was observed in 2016 and 2017. Characterization of partial RNA-dependent RNA polymerase and VP1 nucleotide sequences of GII.2 strains revealed that more than half of the GII.2 strains circulating in 2016 and 2017 were recombinant strains of GII.P16/GII.2. For SaV, the majority of strains belonged to GI.1 (55.6%) and GI.2 (33.3%), while GII.5 accounted for 11.1%. In conclusion, this study demonstrates the diversity of NoV and SaV, and the emergence of NoV GII.P16/GII.2 recombinant strains in 2016 and 2017 in Chiang Mai, Thailand.

Evidence for Cross-Species Transmission of Covert Mortality Nodavirus to New Host of Mugilogobius abei.

Viral covert mortality disease (VCMD), caused by covert mortality nodavirus (CMNV), is a newly emerging disease affecting most cultured shrimp and other crustaceans, but not fish. However, we discovered for the first time that Mugilogobius abei, a common marine fish collecting from shrimp farming ponds and surrounding coastal waters in China, was tested to be CMNV positive based on reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay. Further investigation based on the quantitative RT-LAMP assay indicated that 39% individuals of sampled M. abei were CMNV positive. Sequencing and alignment of sequences revealed that the partial RNA-dependent RNA polymerase gene of CMNV isolated from M. abei shared 98% homology with that from the original CMNV isolates. Histopathological analysis showed that CMNV infection in M. abei could induce extensive skeletal muscle necrosis, nervous tissue vacuolation in retina of eye and cerebellum of brain. Positive signals were verified in skeletal muscle, eye, brain and intestine by in situ hybridization (ISH) with CMNV probes. Under transmission electron microscope (TEM), CMNV particles were further visualized in the cytoplasm of neurogliocytes, granulocytes and myocytes in the CMNV positive samples diagnosed by ISH. All findings suggested that CMNV, a typical alphanodavirus originated from shrimp, could switch their hosts to fish by cross-species transmission. Meanwhile, the results reminded us to pay close attention to the high risk of CMNV to use fish as intermediate or new host as well as potentially spread or cause epidemic among cultured marine fish.